Mary Jane Megan Litecoin Game Dog - Mix of Boxer, Rottweiler, Golder Retriever, Shiba Inu, Border Collie, Husky and Dachshund

Achievements

None
Mary Jane Megan
You can call me Mary Jane Megan, everybody else does. I'm going kill that damn Nyan Cat if I can catch it. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 14%
  • Age 56 days
  • Racing Exp 0
  • Boxer 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACAGAGTACACTACACAAACAACAACGGAAAC
C
A
C
A
G
A
G
T
A
C
A
C
T
A
C
A
C
A
A
A
C
A
A
C
A
A
C
G
G
A
A
A
C
Genes: H8EHJ4GGGAG

Composition

Boxer
36%
Rottweiler
18%
Golder Retriever
9%
Shiba Inu
9%
Border Collie
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality +9 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Golder Retriever
Legs Shiba Inu
Front Legs Rottweiler
Head Border Collie
Ears Husky
Snout Boxer
Mouth Boxer
Nose Boxer
Eyes Dachshund
Color Boxer