Bimmer Beamer Crypto Dog - Mix of Pug, Husky, Shiba Inu, Golder Retriever, Labrador, Beagle and Dachshund

Achievements

None
Bimmer Beamer
Bimmer Beamer here. Wanna play? You can access my database anytime with your WiFi. I'll lick anything. You know the worst? Watching my humans 'get it on' when I've got no one. I'm the best at running circle 8's. I've been solitary dog...looking for someone worth changing over.
  • Purity 11%
  • Age 56 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGTAAGACCAACAACACTAGAAGGAGAAACA
G
A
A
G
T
A
A
G
A
C
C
A
A
C
A
A
C
A
C
T
A
G
A
A
G
G
A
G
A
A
A
C
A
Genes: 2E8544D2A24

Composition

Pug
27%
Husky
27%
Shiba Inu
9%
Golder Retriever
9%
Labrador
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Golder Retriever
Front Legs Labrador
Head Husky
Ears Husky
Snout Beagle
Mouth Pug
Nose Dachshund
Eyes Pug
Color Husky