Wiz Wyatt Digital Cryptocurrency Dog - Mix of Maltese, Golder Retriever, St. Bernard, Beagle and Husky

Achievements

None
Wiz Wyatt
Salutations! My name's Wiz Wyatt. I live life by my favorite quote "Every dog has it's day", but every day is my day! I cry whenever I hear an ambulance siren! I like to play fetch with a tennis ball. If we can run as a pack for a while, I'm open to that.
  • Purity 26%
  • Age 54 days
  • Racing Exp 0
  • Maltese 45%
  • 0 races
  • Gen 11
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAACCACCACCCTAAGAAGAAGAACCACAACC
T
G
A
A
C
C
A
C
C
A
C
C
C
T
A
A
G
A
A
G
A
A
G
A
A
C
C
A
C
A
A
C
C
Genes: BKKKD888K4K

Composition

Maltese
45%
Golder Retriever
27%
St. Bernard
9%
Beagle
9%
Husky
9%

Current Energy

Vitality -32 points
Lunar Effect +8 points

Traits Breakdown

Body St. Bernard
Tail Maltese
Legs Maltese
Front Legs Maltese
Head Beagle
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Maltese
Eyes Husky
Color Maltese

Parents

No Children