Chopper Colonel Litecoin Game Dog - Mix of Yorkshire Terrier, Shiba Inu, Rottweiler, Golder Retriever, French Bulldog, Boxer, Maltese, Pitbull terrier and St. Bernard

Achievements

None
Chopper Colonel
Howdy there. I'm Chopper Colonel. I like nibbling on most everything, but I'll bite if you want me to. I don't understand why I like smelling butts... I absolutely love long walks when I can stop and smell the bushes. I hate never catching that damn rabbit in my dreams.
  • Purity 3%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACACAGACGAAACACCTCCTGAGTATTAGTA
T
T
A
C
A
C
A
G
A
C
G
A
A
A
C
A
C
C
T
C
C
T
G
A
G
T
A
T
T
A
G
T
A
Genes: FH89GKNBEFE

Composition

Yorkshire Terrier
18%
Shiba Inu
18%
Rottweiler
9%
Golder Retriever
9%
French Bulldog
9%
Boxer
9%
Maltese
9%
Pitbull terrier
9%
St. Bernard
9%

Current Energy

Vitality 0 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Rottweiler
Legs Golder Retriever
Front Legs French Bulldog
Head Boxer
Ears Maltese
Snout Pitbull terrier
Mouth St. Bernard
Nose Shiba Inu
Eyes Yorkshire Terrier
Color Shiba Inu