Cersei Cutey Honey Digital Cryptocurrency Dog - Mix of St. Bernard, Husky, Dachshund, Labrador, Yorkshire Terrier, Rottweiler and French Bulldog

Achievements

None
Cersei Cutey Honey
As a designer, I suggest low windows or couch backs next to windows without curtains. I hate having to share my food dish... I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I pee when I'm excited. I'm just looking for some puppy love.
  • Purity 9%
  • Age 4 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCATGATTATGATGAACACACGGAACACGAGGA
C
C
A
T
G
A
T
T
A
T
G
A
T
G
A
A
C
A
C
A
C
G
G
A
A
C
A
C
G
A
G
G
A
Genes: 5BFBB4HA49A

Composition

St. Bernard
27%
Husky
18%
Dachshund
18%
Labrador
9%
Yorkshire Terrier
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect +10 points

Traits Breakdown

Body Labrador
Tail St. Bernard
Legs Yorkshire Terrier
Front Legs St. Bernard
Head St. Bernard
Ears Husky
Snout Rottweiler
Mouth Dachshund
Nose Husky
Eyes French Bulldog
Color Dachshund

Parents

No Children