Tidus Trouble Cryptocurrency Dog - Mix of Pug, Labrador, Labrador BK, Golder Retriever, Dachshund, Boxer, Husky, Corgi and Rottweiler

Achievements

None
Tidus Trouble
Aggressive dogs that don't let 'me be me' frustrate me. As a designer, I suggest low windows or couch backs next to windows without curtains. I love it when you show a little teeth. I love the smell of freshly cut grass.
  • Purity 3%
  • Age 54 days
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGAGGAGAAAACACAGAACCAAGCCACCCA
G
C
A
A
G
A
G
G
A
G
A
A
A
A
C
A
C
A
G
A
A
C
C
A
A
G
C
C
A
C
C
C
A
Genes: 68A2G425OH5

Composition

Pug
18%
Labrador
18%
Labrador BK
9%
Golder Retriever
9%
Dachshund
9%
Boxer
9%
Husky
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -5 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Dachshund
Front Legs Pug
Head Boxer
Ears Husky
Snout Pug
Mouth Labrador
Nose Corgi
Eyes Rottweiler
Color Labrador