Perla Pixie Crypto Dog - Mix of Corgi, Beagle, Dachshund, Rottweiler, Maltese, Pitbull terrier, Labrador and Pug

Achievements

None
Perla Pixie
Here in cyberspace, I ain't got much use for a floppy disc. I enjoy destroying a nice fresh pair of slippers. I have a crush on the Grumpy cat. My favorite game is Fetch except I never bring the ball back. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 6%
  • Age 54 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACAGCCTAACCAGCGGAGGACTATCCCCAGAA
C
A
C
A
G
C
C
T
A
A
C
C
A
G
C
G
G
A
G
G
A
C
T
A
T
C
C
C
C
A
G
A
A
Genes: HODKOAADN52

Composition

Corgi
18%
Beagle
18%
Dachshund
18%
Rottweiler
9%
Maltese
9%
Pitbull terrier
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -12 points
Lunar Effect -2 points

Traits Breakdown

Body Rottweiler
Tail Corgi
Legs Beagle
Front Legs Maltese
Head Corgi
Ears Dachshund
Snout Dachshund
Mouth Beagle
Nose Pitbull terrier
Eyes Labrador
Color Pug