Mary Moochie Bitcoin Dog - Mix of Pitbull terrier, St. Bernard, Pug, Shiba Inu and Dachshund

Achievements

None
Mary Moochie
If you'd like to get together, I'm Mary Moochie. I'm 100% digital, baby. I've had my nose rubbed in 'it' more than once. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! My favorite sport is catching treats my human throws!
  • Purity 21%
  • Age 54 days
  • Racing Exp 0
  • Pitbull terrier 45%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTGAGTAGGATCCTCCGAATCCTGAGAATCC
T
C
C
T
G
A
G
T
A
G
G
A
T
C
C
T
C
C
G
A
A
T
C
C
T
G
A
G
A
A
T
C
C
Genes: NBEANN2NB2N

Composition

Pitbull terrier
45%
St. Bernard
18%
Pug
18%
Shiba Inu
9%
Dachshund
9%

Current Energy

Vitality -7 points
Lunar Effect +2 points

Traits Breakdown

Body Pitbull terrier
Tail St. Bernard
Legs Shiba Inu
Front Legs Dachshund
Head Pitbull terrier
Ears Pitbull terrier
Snout Pug
Mouth Pitbull terrier
Nose St. Bernard
Eyes Pug
Color Pitbull terrier

Parents

No Children