Moe Mulligan Litecoin Game Dog - Mix of Beagle, French Bulldog, Border Collie, Corgi, Maltese, Pug, Yorkshire Terrier, Rottweiler and Pitbull terrier

Achievements

None
Moe Mulligan
Hey, good-looking! This is Moe Mulligan. In my digital world, cats aren't the only ones who hack. I hate bubble baths; mud puddles are more my style. I have a crush on the Grumpy cat. My favorite position is doggie style ;) I love waking up early then indulging in long afternoon naps.
  • Purity 3%
  • Age 56 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACCGACTAAGCACCGAATTACGACACTCC
C
T
A
T
A
C
C
G
A
C
T
A
A
G
C
A
C
C
G
A
A
T
T
A
C
G
A
C
A
C
T
C
C
Genes: DJ9DOK2F9HN

Composition

Beagle
18%
French Bulldog
18%
Border Collie
9%
Corgi
9%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality -15 points
Lunar Effect +10 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs French Bulldog
Front Legs Beagle
Head Corgi
Ears Maltese
Snout Pug
Mouth Yorkshire Terrier
Nose French Bulldog
Eyes Rottweiler
Color Pitbull terrier