Cloud Crash Bandicoot Bitcoin Game Dog - Mix of Golder Retriever, Shiba Inu, Corgi, Border Collie and Yorkshire Terrier

Achievements

None
Cloud Crash Bandicoot
Hey! Call me Cloud Crash Bandicoot. Once you go digital, baby, you never go back. I've always had a crush on Lassie. My favorite pastime is playing tug-of-war with my human's underwear. I am really into starting howling wars with the neighborhood dogs. I'm the loudest!
  • Purity 31%
  • Age 57 days
  • Racing Exp 0
  • Golder Retriever 55%
  • 0 races
  • Gen 8
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAAGAAGAAGAAGAAGCGTATACTTAAGAAGA
G
T
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
T
A
C
T
T
A
A
G
A
A
G
A
Genes: E8888OEJF88

Composition

Golder Retriever
55%
Shiba Inu
18%
Corgi
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Border Collie
Nose Yorkshire Terrier
Eyes Golder Retriever
Color Golder Retriever