Ozzie Olivia Bitcoin Dog - Mix of Boxer, Yorkshire Terrier, Poodle, Shiba Inu, Corgi, Dachshund, Border Collie, Grey Wolf and Rottweiler

Achievements

Racer
Podium Champion
Ozzie Olivia
Salutations! My name's Ozzie Olivia. Hope you like the smell of wet fur, because I'll jump into any water I see! I like shaking my fur next to humans right after a good swim! Too much steak gives me the runs! I'm not into dog collars, unless you're into S & M.
  • Purity 3%
  • Age 39 months
  • Racing Exp 42
  • Boxer 18%
  • 13 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

13 races   |
  • 1 2 2
 Best Time15.05 sec
No rank  Racing *** Pts
38.5 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGTAAACAGCGGATTAAACTACCCCTTACAC
G
A
C
G
T
A
A
A
C
A
G
C
G
G
A
T
T
A
A
A
C
T
A
C
C
C
C
T
T
A
C
A
C
Genes: IEGOAFGJLFH

Composition

Boxer
18%
Yorkshire Terrier
18%
Poodle
9%
Shiba Inu
9%
Corgi
9%
Dachshund
9%
Border Collie
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -50 points
Lunar Effect -12 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Boxer
Front Legs Corgi
Head Dachshund
Ears Yorkshire Terrier
Snout Boxer
Mouth Border Collie
Nose Grey Wolf
Eyes Yorkshire Terrier
Color Rottweiler

Parents

No Children

Photos

cryptocurrency dog racing results virtual pet racing podium online pet race photo online doggy racing Litecoin dog racing podium virtual pet race online dog racing virtual canine race podium