Chalupa Capone Crypto Dog - Mix of Corgi, Poodle, Golder Retriever, German Shepard, St. Bernard, Labrador, Border Collie and Rottweiler

Achievements

None
Chalupa Capone
Hi! I'm Chalupa Capone! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! As a perfectionist, I have to find just the right 'spot'. I'm into leather...if I have the right partner. Slipping my collar, running off and making my humans worried? Every chance I get.
  • Purity 8%
  • Age 58 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACAGATCATGACCAAGCAGCTACCACGACAGC
G
A
C
A
G
A
T
C
A
T
G
A
C
C
A
A
G
C
A
G
C
T
A
C
C
A
C
G
A
C
A
G
C
Genes: I87B5OOJHIO

Composition

Corgi
27%
Poodle
18%
Golder Retriever
9%
German Shepard
9%
St. Bernard
9%
Labrador
9%
Border Collie
9%
Rottweiler
9%

Current Energy

Vitality +4 points
Lunar Effect -10 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs German Shepard
Front Legs St. Bernard
Head Labrador
Ears Corgi
Snout Corgi
Mouth Border Collie
Nose Rottweiler
Eyes Poodle
Color Corgi