Stitch Sven Bitcoin Dog - Mix of Beagle, Boxer, German Shepard, Dachshund, Yorkshire Terrier, Golder Retriever, Rottweiler and Husky

Achievements

None
Stitch Sven
When I hook up, I stay hooked up for about 20 minutes. Hope you like the smell of wet fur, because I'll jump into any water I see! I don't like to be ignored. I like to play fetch with a tennis ball. If we can run as a pack for a while, I'm open to that.
  • Purity 8%
  • Age 58 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCAGGATTAAACCTACTAAGACACCTAACA
A
A
C
T
C
A
G
G
A
T
T
A
A
A
C
C
T
A
C
T
A
A
G
A
C
A
C
C
T
A
A
C
A
Genes: G7AFGDD8HD4

Composition

Beagle
27%
Boxer
18%
German Shepard
9%
Dachshund
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Rottweiler
9%
Husky
9%

Current Energy

Vitality -9 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs Dachshund
Front Legs Yorkshire Terrier
Head Boxer
Ears Beagle
Snout Beagle
Mouth Golder Retriever
Nose Rottweiler
Eyes Beagle
Color Husky