Obie Ozzie Bitcoin Game Dog - Mix of Corgi, Pug, Beagle, St. Bernard, French Bulldog, Dachshund and Boxer

Achievements

None
Obie Ozzie
Sup? ;-) I'm Obie Ozzie. I'm all about a hard drive because you can't do anything with a floppy disc. I like exploring off leash best. I don't like going to the groomer. Leave my beautiful fur alone! My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 12%
  • Age 56 days
  • Racing Exp 0
  • Corgi 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAAGCCTAGAATGACGAAGCAGCGGAAACAGC
G
A
A
A
G
C
C
T
A
G
A
A
T
G
A
C
G
A
A
G
C
A
G
C
G
G
A
A
A
C
A
G
C
Genes: 2OD2B9OOAGO

Composition

Corgi
36%
Pug
18%
Beagle
9%
St. Bernard
9%
French Bulldog
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality -34 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Corgi
Legs Beagle
Front Legs Pug
Head St. Bernard
Ears French Bulldog
Snout Corgi
Mouth Corgi
Nose Dachshund
Eyes Boxer
Color Corgi

Parents

No Children