Rouge The Bat Rolex Crypto Dog - Mix of St. Bernard, Golder Retriever, Boxer, German Shepard, Labrador, French Bulldog and Yorkshire Terrier

Achievements

None
Rouge The Bat Rolex
You can access my database anytime with your WiFi. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! You know the worst? Watching my humans 'get it on' and I have to lick myself. I adore sleeping upside down with my tongue hanging out!
  • Purity 7%
  • Age 12 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAAGAAACTCACCACGATGAAGATGAAACTTA
T
G
A
A
G
A
A
A
C
T
C
A
C
C
A
C
G
A
T
G
A
A
G
A
T
G
A
A
A
C
T
T
A
Genes: B8G759B8BGF

Composition

St. Bernard
27%
Golder Retriever
18%
Boxer
18%
German Shepard
9%
Labrador
9%
French Bulldog
9%
Yorkshire Terrier
9%

Current Energy

Vitality -53 points
Lunar Effect +8 points

Traits Breakdown

Body St. Bernard
Tail Golder Retriever
Legs Boxer
Front Legs German Shepard
Head Labrador
Ears French Bulldog
Snout St. Bernard
Mouth Golder Retriever
Nose St. Bernard
Eyes Boxer
Color Yorkshire Terrier