Kate Kenya Bitcoin Dog - Mix of Yorkshire Terrier, Corgi, Golder Retriever, German Shepard, Dachshund, Husky and French Bulldog

Achievements

None
Kate Kenya
Hello there, my name is Kate Kenya. As a digital dog, let me say Bob Dole did not invent the internet. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I'm the best at running circle 8's. I'm always up for some puppy action, is that wrong?
  • Purity 9%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGAACAAGCTTAAGAAGCAGATTATTACGA
T
C
A
G
G
A
A
C
A
A
G
C
T
T
A
A
G
A
A
G
C
A
G
A
T
T
A
T
T
A
C
G
A
Genes: 7A4OF8O8FF9

Composition

Yorkshire Terrier
27%
Corgi
18%
Golder Retriever
18%
German Shepard
9%
Dachshund
9%
Husky
9%
French Bulldog
9%

Current Energy

Vitality +6 points
Lunar Effect -14 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Husky
Front Legs Corgi
Head Yorkshire Terrier
Ears Golder Retriever
Snout Corgi
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color French Bulldog