Skinny Smoky Litecoin Dog - Mix of French Bulldog, Border Collie, Pug, St. Bernard, Labrador BK, Beagle and Husky

Achievements

None
Skinny Smoky
I'm Skinny Smoky. What do they call you? This dawg chases mice in a big data warehouse. I'm an avid runner! Outside, inside, all over the place! I just want to run! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 11%
  • Age 59 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTGAGCATACCTAACACGAGAAGAACGACGA
T
A
C
T
G
A
G
C
A
T
A
C
C
T
A
A
C
A
C
G
A
G
A
A
G
A
A
C
G
A
C
G
A
Genes: JB6JD492299

Composition

French Bulldog
27%
Border Collie
18%
Pug
18%
St. Bernard
9%
Labrador BK
9%
Beagle
9%
Husky
9%

Current Energy

Vitality +11 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Labrador BK
Front Legs Border Collie
Head Beagle
Ears Husky
Snout French Bulldog
Mouth Pug
Nose Pug
Eyes French Bulldog
Color French Bulldog