Sheba Scout Digital Cryptocurrency Dog - Mix of Pitbull terrier, Rottweiler, Border Collie, German Shepard, Dachshund, Golder Retriever, Grey Wolf and Husky

Achievements

None
Sheba Scout
I'm Sheba Scout and I'd like to show you a trick or two. Size matters. This dawg's into big databases. Trust me. Leashes, collar and whips can be fun if you know what you're doing. My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 8%
  • Age 60 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTCCTACTCAGGATCCAGACCCTCCACACAC
C
A
C
T
C
C
T
A
C
T
C
A
G
G
A
T
C
C
A
G
A
C
C
C
T
C
C
A
C
A
C
A
C
Genes: HNJ7AN8LN4H

Composition

Pitbull terrier
27%
Rottweiler
18%
Border Collie
9%
German Shepard
9%
Dachshund
9%
Golder Retriever
9%
Grey Wolf
9%
Husky
9%

Current Energy

Vitality +18 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Border Collie
Front Legs German Shepard
Head Dachshund
Ears Pitbull terrier
Snout Golder Retriever
Mouth Grey Wolf
Nose Pitbull terrier
Eyes Husky
Color Rottweiler