Grover Guinness Crypto Game Dog - Mix of Pug, Rottweiler, St. Bernard, Labrador BK, Golder Retriever, Dachshund, Border Collie and Pitbull terrier

Achievements

None
Grover Guinness
Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Don't bother contacting me if you like cats. My favorite sport is catching treats my human throws! I'll outrun you for the ball if I can...that's just how I roll.
  • Purity 8%
  • Age 60 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGAGAAGCAAGAGGATACGAAGAACACTCC
C
A
C
T
G
A
G
A
A
G
C
A
A
G
A
G
G
A
T
A
C
G
A
A
G
A
A
C
A
C
T
C
C
Genes: HB268AJ22HN

Composition

Pug
27%
Rottweiler
18%
St. Bernard
9%
Labrador BK
9%
Golder Retriever
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%

Current Energy

Vitality -4 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Pug
Front Legs Labrador BK
Head Golder Retriever
Ears Dachshund
Snout Border Collie
Mouth Pug
Nose Pug
Eyes Rottweiler
Color Pitbull terrier