Gabriella Gamma Cryptocurrency Game Dog - Mix of Husky, German Shepard, Boxer, Labrador, Yorkshire Terrier and Pug

Achievements

None
Gabriella Gamma
My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I've been solitary dog...looking for someone worth changing over.
  • Purity 17%
  • Age 4 months
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 18
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAAACAACTTAGAAACATCATCATCAACAACA
C
C
A
A
A
C
A
A
C
T
T
A
G
A
A
A
C
A
T
C
A
T
C
A
T
C
A
A
C
A
A
C
A
Genes: 5GGF2477744

Composition

Husky
27%
German Shepard
27%
Boxer
18%
Labrador
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality -33 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Boxer
Front Legs Yorkshire Terrier
Head Pug
Ears Husky
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes Husky
Color Husky