Morpheus Mulligan Digital Cryptocurrency Dog - Mix of Boxer, Schnauzer, Corgi, Border Collie, German Shepard, Rottweiler, Beagle and Pug

Achievements

None
Morpheus Mulligan
You can call me Morpheus Mulligan, everybody else does. I don't appreciate being around bores who bark too much. Rolling around on the carpet after a bath is my favorite way to dry. My humans say I slobber too much, but hey, I'm just juicy. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!
  • Purity 9%
  • Age 60 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACAACAGCTACATATCACACCTAATAGAAAAC
A
A
C
A
A
C
A
G
C
T
A
C
A
T
A
T
C
A
C
A
C
C
T
A
A
T
A
G
A
A
A
A
C
Genes: GGOJC7HDC2G

Composition

Boxer
27%
Schnauzer
18%
Corgi
9%
Border Collie
9%
German Shepard
9%
Rottweiler
9%
Beagle
9%
Pug
9%

Current Energy

Vitality -4 points
Lunar Effect -2 points

Traits Breakdown

Body Boxer
Tail Boxer
Legs Corgi
Front Legs Border Collie
Head Schnauzer
Ears German Shepard
Snout Rottweiler
Mouth Beagle
Nose Schnauzer
Eyes Pug
Color Boxer