Keaton Kellie Bitcoin Dog - Mix of Border Collie, Labrador, Grey Wolf, Shiba Inu, Pitbull terrier, Pug and Beagle

Achievements

None
Keaton Kellie
I'm Keaton Kellie and I'd like to show you a trick or two. I'd like to take you for a byte to eat in cyberspace. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 11%
  • Age 57 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 14
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACCCACCAGTACCCTACTCCCCCGAACTA
T
A
C
T
A
C
C
C
A
C
C
A
G
T
A
C
C
C
T
A
C
T
C
C
C
C
C
G
A
A
C
T
A
Genes: JJ55ELJNL2D

Composition

Border Collie
27%
Labrador
18%
Grey Wolf
18%
Shiba Inu
9%
Pitbull terrier
9%
Pug
9%
Beagle
9%

Current Energy

Vitality +17 points
Lunar Effect -6 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Labrador
Front Legs Labrador
Head Shiba Inu
Ears Grey Wolf
Snout Border Collie
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Pug
Color Beagle