Boomer Bitsy Cryptocurrency Game Dog - Mix of Husky, Border Collie, Beagle, Grey Wolf, Boxer, Corgi, Maltese and Labrador BK

Achievements

None
Boomer Bitsy
Good day to you! I'm Boomer Bitsy! I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. People food disagrees with me. Whew! You can tell. I'm into recreational spankings and a little 'ruff' play. I don't like it when my bowl is empty, so I take it to my human and it magically refills!
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 5
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACCTAACAACACCCAACACAAGCACCGCAACA
T
A
C
C
T
A
A
C
A
A
C
A
C
C
C
A
A
C
A
C
A
A
G
C
A
C
C
G
C
A
A
C
A
Genes: JD44LG4OK64

Composition

Husky
36%
Border Collie
9%
Beagle
9%
Grey Wolf
9%
Boxer
9%
Corgi
9%
Maltese
9%
Labrador BK
9%

Current Energy

Vitality +8 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Beagle
Legs Husky
Front Legs Husky
Head Grey Wolf
Ears Boxer
Snout Husky
Mouth Corgi
Nose Maltese
Eyes Labrador BK
Color Husky