Argos Artie Bitcoin Dog - Mix of Shiba Inu, Boxer, Rottweiler, Golder Retriever, Corgi, Maltese, Yorkshire Terrier, Border Collie, Pug, Beagle and German Shepard

Achievements

None
Argos Artie
My favorite way to spend playtime is a good game of frisbee. I love cuddling up, doggy-style after a romantic evening. When I hook up, I stay hooked up for about 20 minutes. I don't appreciate being around bores who bark too much.
  • Purity 0%
  • Age 60 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAAACCACAGAAGCACCTTATACGAACTATCA
G
T
A
A
A
C
C
A
C
A
G
A
A
G
C
A
C
C
T
T
A
T
A
C
G
A
A
C
T
A
T
C
A
Genes: EGH8OKFJ2D7

Composition

Shiba Inu
9%
Boxer
9%
Rottweiler
9%
Golder Retriever
9%
Corgi
9%
Maltese
9%
Yorkshire Terrier
9%
Border Collie
9%
Pug
9%
Beagle
9%
German Shepard
9%

Current Energy

Vitality +3 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Boxer
Legs Rottweiler
Front Legs Golder Retriever
Head Corgi
Ears Maltese
Snout Yorkshire Terrier
Mouth Border Collie
Nose Pug
Eyes Beagle
Color German Shepard

Parents

No Children