Maddux Mila Crypto Dog - Mix of French Bulldog, Border Collie, Maltese, Dachshund, Shiba Inu, Poodle, Yorkshire Terrier, Pitbull terrier, Labrador, Golder Retriever and Pug

Achievements

None
Maddux Mila
They call me Maddux Mila. What's your name? Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I've always wanted to be in commercials and be treated as the star I am! I hate bubble baths; mud puddles are more my style.
  • Purity 0%
  • Age 60 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGATACACCGGAGTAGACTTATCCCCAAGAGAA
C
G
A
T
A
C
A
C
C
G
G
A
G
T
A
G
A
C
T
T
A
T
C
C
C
C
A
A
G
A
G
A
A
Genes: 9JKAEIFN582

Composition

French Bulldog
9%
Border Collie
9%
Maltese
9%
Dachshund
9%
Shiba Inu
9%
Poodle
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Labrador
9%
Golder Retriever
9%
Pug
9%

Current Energy

Vitality -10 points
Lunar Effect -12 points

Traits Breakdown

Body French Bulldog
Tail Border Collie
Legs Maltese
Front Legs Dachshund
Head Shiba Inu
Ears Poodle
Snout Yorkshire Terrier
Mouth Pitbull terrier
Nose Labrador
Eyes Golder Retriever
Color Pug

Parents

No Children