Breeze Batter Bitcoin Dog - Mix of Rottweiler, Shiba Inu, Pitbull terrier, Poodle, Husky, Border Collie, Labrador, Dachshund, Golder Retriever, Boxer and Pug

Achievements

None
Breeze Batter
Good day to you! I'm Breeze Batter! Ima Ethernet dog. Blue toilet water turns me off. I'm always up for a nice long walk around the neighborhood. I pee when I'm excited. Little Bow Wow is my favorite musician. I just assume he's a dog... I'm looking for a hard-working service animal who can keep up with me.
  • Purity 0%
  • Age 60 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGTATCCGACACATACCCAGGAAGAAACGAA
C
A
C
G
T
A
T
C
C
G
A
C
A
C
A
T
A
C
C
C
A
G
G
A
A
G
A
A
A
C
G
A
A
Genes: HENI4J5A8G2

Composition

Rottweiler
9%
Shiba Inu
9%
Pitbull terrier
9%
Poodle
9%
Husky
9%
Border Collie
9%
Labrador
9%
Dachshund
9%
Golder Retriever
9%
Boxer
9%
Pug
9%

Current Energy

Vitality +5 points
Lunar Effect -12 points

Traits Breakdown

Body Rottweiler
Tail Shiba Inu
Legs Pitbull terrier
Front Legs Poodle
Head Husky
Ears Border Collie
Snout Labrador
Mouth Dachshund
Nose Golder Retriever
Eyes Boxer
Color Pug

Parents

No Children