Levi Luke Cryptocurrency Game Dog - Mix of St. Bernard, Maltese, Yorkshire Terrier, Corgi, Pitbull terrier, Labrador BK, Pug and Labrador

Achievements

None
Levi Luke
Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. I'll eat my vomit and yours too. Blue toilet water turns me off. The absolute best time of day is dinner time!
  • Purity 8%
  • Age 2 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATTATGAACCACCTGAAGCTCCGCAGAACCA
T
G
A
T
T
A
T
G
A
A
C
C
A
C
C
T
G
A
A
G
C
T
C
C
G
C
A
G
A
A
C
C
A
Genes: BFBKKBON625

Composition

St. Bernard
27%
Maltese
18%
Yorkshire Terrier
9%
Corgi
9%
Pitbull terrier
9%
Labrador BK
9%
Pug
9%
Labrador
9%

Current Energy

Vitality -26 points
Lunar Effect -8 points

Traits Breakdown

Body St. Bernard
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Maltese
Head Maltese
Ears St. Bernard
Snout Corgi
Mouth Pitbull terrier
Nose Labrador BK
Eyes Pug
Color Labrador