Astra Alden Crypto Dog - Mix of Poodle, German Shepard, Schnauzer, St. Bernard, Dachshund, Boxer, Pug, Rottweiler, Labrador, Husky and Yorkshire Terrier

Achievements

None
Astra Alden
Well hello, beautiful. My name's Astra Alden. I was born in the web cloud. I hate having to share my food dish... If I had to pick a favorite food it would be a hot-dog, because you are what you eat! Size doesn't matter, I like 'em all. Sometimes I just have to roll in something dead.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACTCAATATGAGGAAACGAACACCCAACATTA
G
A
C
T
C
A
A
T
A
T
G
A
G
G
A
A
A
C
G
A
A
C
A
C
C
C
A
A
C
A
T
T
A
Genes: I7CBAG2H54F

Composition

Poodle
9%
German Shepard
9%
Schnauzer
9%
St. Bernard
9%
Dachshund
9%
Boxer
9%
Pug
9%
Rottweiler
9%
Labrador
9%
Husky
9%
Yorkshire Terrier
9%

Current Energy

Vitality -10 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail German Shepard
Legs Schnauzer
Front Legs St. Bernard
Head Dachshund
Ears Boxer
Snout Pug
Mouth Rottweiler
Nose Labrador
Eyes Husky
Color Yorkshire Terrier

Parents

No Children