Droolius Caesar Diva Crypto Dog - Pure German Shepard

Achievements

None
Droolius Caesar Diva
Yo! I'm Droolius Caesar Diva and I'd like to rock your world. I never met a crotch or a butt I didn't like, but I'm just friendly that way. I love a good book... I find them quite tasty. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Getting out of a long relationship, not looking for another
  • Purity 100%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 15
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +8 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard