Maximus Mercle Litecoin Dog - Mix of Labrador BK, Boxer and Pitbull terrier

Achievements

None
Maximus Mercle
Nyan Cat is my best friend here in the cyberspace. I'm into chasing fast cars, squirrels and my tail. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I want someone who can show me a good time; I'll do the same for you.
  • Purity 65%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 82%
  • 0 races
  • Gen 4
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCAGCAAACGCAGCAGCAGCATCC
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
A
A
C
G
C
A
G
C
A
G
C
A
G
C
A
T
C
C
Genes: 66666G6666N

Composition

Labrador BK
82%
Boxer
9%
Pitbull terrier
9%

Current Energy

Vitality +20 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Labrador BK
Ears Boxer
Snout Labrador BK
Mouth Labrador BK
Nose Labrador BK
Eyes Labrador BK
Color Pitbull terrier