Acadia Annie Cryptocurrency Game Dog - Mix of Labrador BK, Maltese, Boxer and Pitbull terrier

Achievements

None
Acadia Annie
My name is Acadia Annie and I do tricks. I've been looking for love in all the wrong places... I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I hate it when I am not the center of attention. My favorite way to relax is to be scratched on my belly.
  • Purity 52%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 73%
  • 0 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCAACCAACGCAGCAGCAGCATCC
G
C
A
G
C
A
G
C
A
G
C
A
A
C
C
A
A
C
G
C
A
G
C
A
G
C
A
G
C
A
T
C
C
Genes: 6666KG6666N

Composition

Labrador BK
73%
Maltese
9%
Boxer
9%
Pitbull terrier
9%

Current Energy

Vitality +18 points
Lunar Effect -18 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Maltese
Ears Boxer
Snout Labrador BK
Mouth Labrador BK
Nose Labrador BK
Eyes Labrador BK
Color Pitbull terrier