Amaterasu Abigail Litecoin Game Dog - Mix of Labrador BK, German Shepard, Maltese and Boxer

Achievements

None
Amaterasu Abigail
I hate being left alone all day. I never met a crotch or a butt I didn't like, but I'm just friendly that way. I really enjoy heavy petting. Rolling around on the carpet after a bath is my favorite way to dry. I just want to share a ball with someone, if you know what I mean...
  • Purity 32%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 55%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGCAGCATCAACCAACGCAGCAGCAGCAACC
T
C
A
G
C
A
G
C
A
T
C
A
A
C
C
A
A
C
G
C
A
G
C
A
G
C
A
G
C
A
A
C
C
Genes: 7667KG6666K

Composition

Labrador BK
55%
German Shepard
18%
Maltese
18%
Boxer
9%

Current Energy

Vitality +15 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Labrador BK
Legs Labrador BK
Front Legs German Shepard
Head Maltese
Ears Boxer
Snout Labrador BK
Mouth Labrador BK
Nose Labrador BK
Eyes Labrador BK
Color Maltese