Newt Nibby-Nose Bitcoin Dog - Mix of German Shepard, Border Collie and Husky

Achievements

None
Newt Nibby-Nose
Wassup? Yo, call me Newt Nibby-Nose. I live in cyberspace. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I don't mind sharing my bed with someone I just met, if we can cuddle. I just want to share a ball with someone, if you know what I mean...
  • Purity 65%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 82%
  • 0 races
  • Gen 13
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCATCATCATCATCATCATCAACATCATCA
T
A
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
C
A
T
C
A
T
C
A
Genes: J7777777477

Composition

German Shepard
82%
Border Collie
9%
Husky
9%

Current Energy

Vitality +15 points
Lunar Effect -16 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose Husky
Eyes German Shepard
Color German Shepard