Blaze Bunky Litecoin Dog - Mix of Grey Wolf, Dachshund, Husky, Shiba Inu, Beagle and Labrador BK

Achievements

None
Blaze Bunky
As a perfectionist, I have to find just the right 'spot'. My favorite place in the world is the dog park. So many smells! Sometimes I forget where I buried my bone. Small yappy creatures bug me...they disturb my zen. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 27%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 6
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCGGAACAGTACCCCTACCCCCCCCCGCA
C
C
C
C
C
C
G
G
A
A
C
A
G
T
A
C
C
C
C
T
A
C
C
C
C
C
C
C
C
C
G
C
A
Genes: LLA4ELDLLL6

Composition

Grey Wolf
55%
Dachshund
9%
Husky
9%
Shiba Inu
9%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality -4 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Dachshund
Front Legs Husky
Head Shiba Inu
Ears Grey Wolf
Snout Beagle
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Labrador BK