Faline Ferrari Crypto Dog - Mix of Grey Wolf, Dachshund, Pitbull terrier, German Shepard, Beagle and Border Collie

Achievements

None
Faline Ferrari
You can call me Faline Ferrari, everybody else does. I'd like to take you for a byte to eat in cyberspace. I am a proud show dog. I like showing off my perfect coat! I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk!
  • Purity 27%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 5
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCGGATCCTCACCCCTACCCCCCCCCTAC
C
C
C
C
C
C
G
G
A
T
C
C
T
C
A
C
C
C
C
T
A
C
C
C
C
C
C
C
C
C
T
A
C
Genes: LLAN7LDLLLJ

Composition

Grey Wolf
55%
Dachshund
9%
Pitbull terrier
9%
German Shepard
9%
Beagle
9%
Border Collie
9%

Current Energy

Vitality -9 points
Lunar Effect -10 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Dachshund
Front Legs Pitbull terrier
Head German Shepard
Ears Grey Wolf
Snout Beagle
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Border Collie