Flea Flicker Flounder Digital Cryptocurrency Dog - Mix of Grey Wolf, Dachshund, Labrador, Boxer, German Shepard, Labrador BK, Border Collie and Maltese

Achievements

None
Flea Flicker Flounder
What's up, dog? I'm Flea Flicker Flounder! If I can't reach it to clean it myself, it doesn't need cleaning! I hate going to the vet and will do almost anything to avoid it. I enjoy exploration and am game for anything doggy-style. As a designer, I suggest low windows or couch backs next to windows without curtains.
  • Purity 8%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 4
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCAGGAAACTCAGCATACACCCCCCCCGGA
C
C
C
C
C
A
G
G
A
A
A
C
T
C
A
G
C
A
T
A
C
A
C
C
C
C
C
C
C
C
G
G
A
Genes: L5AG76JKLLA

Composition

Grey Wolf
27%
Dachshund
18%
Labrador
9%
Boxer
9%
German Shepard
9%
Labrador BK
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality -3 points
Lunar Effect -16 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Dachshund
Front Legs Boxer
Head German Shepard
Ears Labrador BK
Snout Border Collie
Mouth Maltese
Nose Grey Wolf
Eyes Grey Wolf
Color Dachshund