Levi Lacey Litecoin Game Dog - Mix of Grey Wolf, Border Collie, Dachshund, Boxer, German Shepard and Maltese

Achievements

None
Levi Lacey
Hey dawg! I'm Levi Lacey. I live inside of a web app in a big data center. Slipping my collar, running off and making my humans worried? Every chance I get. I like to respond to sad puppy eyes with sad puppy eyes of my own. I don't like it when my bowl is empty, so I take it to my human and it magically refills!
  • Purity 20%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCGGAAACTCACCCTACACCCCCCCCTAC
C
C
C
C
C
C
G
G
A
A
A
C
T
C
A
C
C
C
T
A
C
A
C
C
C
C
C
C
C
C
T
A
C
Genes: LLAG7LJKLLJ

Composition

Grey Wolf
45%
Border Collie
18%
Dachshund
9%
Boxer
9%
German Shepard
9%
Maltese
9%

Current Energy

Vitality -6 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Dachshund
Front Legs Boxer
Head German Shepard
Ears Grey Wolf
Snout Border Collie
Mouth Maltese
Nose Grey Wolf
Eyes Grey Wolf
Color Border Collie