Gunther Gatsby Cryptocurrency Game Dog - Mix of Grey Wolf, Beagle, Dachshund, Pitbull terrier, Labrador BK and Border Collie

Achievements

None
Gunther Gatsby
Top o' the mornin' to ya! I'm Gunther Gatsby. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 20%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCGGATCCCTACCCCTAGCACCCCCCTAC
C
C
C
C
C
C
G
G
A
T
C
C
C
T
A
C
C
C
C
T
A
G
C
A
C
C
C
C
C
C
T
A
C
Genes: LLANDLD6LLJ

Composition

Grey Wolf
45%
Beagle
18%
Dachshund
9%
Pitbull terrier
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality -8 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Dachshund
Front Legs Pitbull terrier
Head Beagle
Ears Grey Wolf
Snout Beagle
Mouth Labrador BK
Nose Grey Wolf
Eyes Grey Wolf
Color Border Collie