Taz Tangles Crypto Dog - Mix of St. Bernard, Poodle, Shiba Inu, German Shepard, Grey Wolf, Husky and Border Collie

Achievements

None
Taz Tangles
Howdy potential partner! Taz Tangles here. I run exclusively on code. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I'm a serial monogamist. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 11
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACCCTGAACAGACTACGTAGTAGACTGATGA
T
C
A
C
C
C
T
G
A
A
C
A
G
A
C
T
A
C
G
T
A
G
T
A
G
A
C
T
G
A
T
G
A
Genes: 7LB4IJEEIBB

Composition

St. Bernard
27%
Poodle
18%
Shiba Inu
18%
German Shepard
9%
Grey Wolf
9%
Husky
9%
Border Collie
9%

Current Energy

Vitality -1 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs St. Bernard
Front Legs Husky
Head Poodle
Ears Border Collie
Snout Shiba Inu
Mouth Shiba Inu
Nose Poodle
Eyes St. Bernard
Color St. Bernard

Parents

No Children