Cujo Calvin Litecoin Dog - Mix of Yorkshire Terrier, Schnauzer, Rottweiler, Golder Retriever, Grey Wolf, Pitbull terrier, Border Collie, Boxer and St. Bernard

Achievements

Podium Champion
Pro Racer
Master Champion
TOP 10 Fastest
Cujo Calvin
Hey, good-looking! This is Cujo Calvin. Here in cyberspace, I ain't got much use for a floppy disc. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! If you are looking for companionship without commitment, so am I.
  • Purity 3%
  • Age 2 months
  • Racing Exp 96
  • Yorkshire Terrier 18%
  • 20 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 7 2 3
20 races    Best Time14.90 sec
Rank 8  Racing *** Coins
60.0 % wins (12) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: CACAGACCCTCCTACTTAAACATATGATTAATA
C
A
C
A
G
A
C
C
C
T
C
C
T
A
C
T
T
A
A
A
C
A
T
A
T
G
A
T
T
A
A
T
A
Genes: H8LNJFGCBFC

Composition

Yorkshire Terrier
18%
Schnauzer
18%
Rottweiler
9%
Golder Retriever
9%
Grey Wolf
9%
Pitbull terrier
9%
Border Collie
9%
Boxer
9%
St. Bernard
9%

Current Energy

Vitality +9 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Golder Retriever
Legs Grey Wolf
Front Legs Pitbull terrier
Head Border Collie
Ears Yorkshire Terrier
Snout Boxer
Mouth Schnauzer
Nose St. Bernard
Eyes Yorkshire Terrier
Color Schnauzer