Timmy The Bat Digital Cryptocurrency Dog - Mix of German Shepard, Labrador, Beagle, Border Collie, Husky and Pug

Achievements

None
Timmy The Bat
I've always wanted to be in commercials and be treated as the star I am! I enjoy mixing it up once in a while by visiting different dog parks. I live life by my favorite quote "Every dog has it's day", but every day is my day! Being able to lick myself is nice, but I want to find my special someone.
  • Purity 15%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 7
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACTATACTCAACACCATCACCATCATCAGAA
C
C
A
C
T
A
T
A
C
T
C
A
A
C
A
C
C
A
T
C
A
C
C
A
T
C
A
T
C
A
G
A
A
Genes: 5DJ74575772

Composition

German Shepard
36%
Labrador
27%
Beagle
9%
Border Collie
9%
Husky
9%
Pug
9%

Current Energy

Vitality +15 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador
Tail Beagle
Legs Border Collie
Front Legs German Shepard
Head Husky
Ears Labrador
Snout German Shepard
Mouth Labrador
Nose German Shepard
Eyes German Shepard
Color Pug