Demi Dino Litecoin Game Dog - Mix of Golder Retriever, Grey Wolf and Border Collie

Achievements

Racer
Demi Dino
Howdy potential partner! Demi Dino here. I work in The Virtual Machine. It turns me on when I can show an older dog a new trick. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 55%
  • Age 4 months
  • Racing Exp 22
  • Golder Retriever 73%
  • 3 races
  • Gen 9
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 2 0
 Best Time15.98 sec
No rank  Racing *** Coins
100.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAAGAAGAAGATACAGAAGAAGAAGACCCCCC
A
G
A
A
G
A
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
A
G
A
C
C
C
C
C
C
Genes: 8888J8888LL

Composition

Golder Retriever
73%
Grey Wolf
18%
Border Collie
9%

Current Energy

Vitality -10 points
Lunar Effect +8 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Grey Wolf
Color Grey Wolf