Flora Felix Crypto Game Dog - Pure German Shepard

Achievements

Racer
Flora Felix
I'm a super-dog in the internet universe. I hate bubble baths; mud puddles are more my style. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 100%
  • Age 2 months
  • Racing Exp 8
  • German Shepard 100%
  • 1 races
  • Gen 22
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
1 races    Best Time15.62 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +1 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard