Alucard Alpha Digital Cryptocurrency Dog - Pure German Shepard

Achievements

None
Alucard Alpha
I'm the best at running circle 8's. I pee when I'm excited. As a designer, I suggest low windows or couch backs next to windows without curtains. I hate it when humans put the lid down. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 100%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 17
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -2 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard

Parents

No Children