Maximus Makoto Digital Cryptocurrency Dog - Pure German Shepard

Achievements

Racer
Maximus Makoto
I'm a super-dog in the internet universe. Eat, sleep, poop. Honey, I've got it made. I never met a leg I didn't want to hump. I don't like to be ignored. I love fetching anything my human throws! I've been solitary dog...looking for someone worth changing over.
  • Purity 100%
  • Age 2 months
  • Racing Exp 21
  • German Shepard 100%
  • 8 races
  • Gen 11
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
8 races    Best Time15.38 sec
No rank  Racing *** Coins
25.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -5 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard