Schultz Stich Digital Cryptocurrency Dog - Mix of St. Bernard, Corgi, Dachshund, Husky, Pug and German Shepard

Achievements

None
Schultz Stich
Someday I'm gonna breakout from inside this server. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm not that picky. Wanna mate?
  • Purity 16%
  • Age 41 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGAATCATGATGAGGAAGCAGCAGCGGATGA
A
C
A
G
A
A
T
C
A
T
G
A
T
G
A
G
G
A
A
G
C
A
G
C
A
G
C
G
G
A
T
G
A
Genes: 427BBAOOOAB

Composition

St. Bernard
27%
Corgi
27%
Dachshund
18%
Husky
9%
Pug
9%
German Shepard
9%

Current Energy

Vitality -17 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Pug
Legs German Shepard
Front Legs St. Bernard
Head St. Bernard
Ears Dachshund
Snout Corgi
Mouth Corgi
Nose Corgi
Eyes Dachshund
Color St. Bernard