Schultz Stich Digital Cryptocurrency Dog - Mix of St. Bernard, Corgi, Dachshund, Husky, Pug and German Shepard
Schultz Stich
  • Purity 16%
  • Age 73 months
  • Racing Exp 14
  • St. Bernard 27%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Someday I'm gonna breakout from inside this server. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm not that picky. Wanna mate?

Racing Stats

Ran 2 races
  • 1 0 1
 Best Time14.55 sec
No rank  RacingĀ *** Pts
100.0% wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAGAATCATGATGAGGAAGCAGCAGCGGATGA
A
C
A
G
A
A
T
C
A
T
G
A
T
G
A
G
G
A
A
G
C
A
G
C
A
G
C
G
G
A
T
G
A
Genes: 427BBAOOOAB

Composition

St. Bernard
27%
Corgi
27%
Dachshund
18%
Husky
9%
Pug
9%
German Shepard
9%

Current Energy

Vitality -17 points
Lunar Effect +12 points

Traits Breakdown

Body Husky
Tail Pug
Legs German Shepard
Front Legs St. Bernard
Head St. Bernard
Ears Dachshund
Snout Corgi
Mouth Corgi
Nose Corgi
Eyes Dachshund
Color St. Bernard

Parents

No Children

Photos

Bitcoin dog race online dog racing podium virtual doggy race photo crypto doggy racing virtual pet race Litecoin canine racing results online canine racing results virtual dog race photo
Gift