Petie Piggy Cryptocurrency Game Dog - Mix of St. Bernard, German Shepard and Maltese

Achievements

Racer
Petie Piggy
I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I don't mind sharing my bed with someone I just met, if we can cuddle.
  • Purity 67%
  • Age 12 days
  • Racing Exp 1
  • St. Bernard 82%
  • 1 races
  • Gen 10
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.70 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TGATGATCAACCTGATGATGATGATGATGATGA
T
G
A
T
G
A
T
C
A
A
C
C
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: BB7KBBBBBBB

Composition

St. Bernard
82%
German Shepard
9%
Maltese
9%

Current Energy

Vitality +24 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs German Shepard
Front Legs Maltese
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard

Parents

No Children

Photos