Scooby-Doo Stryker Litecoin Game Dog - Mix of German Shepard, St. Bernard, Border Collie, Pitbull terrier and Husky

Achievements

Racer
Scooby-Doo Stryker
I run on the information superhighway and haven't been hit by a car yet. Air Bud is definitely my favorite movie. What a role model! I like it when you're frisky. My female human wears crotchless undies, but she doesn't like the ones I make for her! I hate being left alone all day.
  • Purity 18%
  • Age 14 days
  • Racing Exp 8
  • German Shepard 36%
  • 3 races
  • Gen 6
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 1
 Best Time17.05 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTGATACTCCACATCATGATCATCATCATGA
T
A
C
T
G
A
T
A
C
T
C
C
A
C
A
T
C
A
T
G
A
T
C
A
T
C
A
T
C
A
T
G
A
Genes: JBJN47B777B

Composition

German Shepard
36%
St. Bernard
27%
Border Collie
18%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality +30 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs Pitbull terrier
Head Husky
Ears German Shepard
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color St. Bernard