Dana Doc Cryptocurrency Dog - Mix of Maltese, Beagle, Border Collie, Rottweiler, French Bulldog and Dachshund

Achievements

Racer
Dana Doc
Hey dawg! I'm Dana Doc. I love waking up early then indulging in long afternoon naps. I'll outrun you for the ball if I can...that's just how I roll. I hate it when my human runs out of poop-bags. How embarrassing! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 17%
  • Age 14 months
  • Racing Exp 14
  • Maltese 36%
  • 2 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 2 0
 Best Time15.73 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACACCACCACCACCCACCGACTATACGGA
C
T
A
T
A
C
A
C
C
A
C
C
A
C
C
A
C
C
C
A
C
C
G
A
C
T
A
T
A
C
G
G
A
Genes: DJKKKKH9DJA

Composition

Maltese
36%
Beagle
18%
Border Collie
18%
Rottweiler
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -65 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Maltese
Front Legs Maltese
Head Maltese
Ears Maltese
Snout Rottweiler
Mouth French Bulldog
Nose Beagle
Eyes Border Collie
Color Dachshund