Dana Doc Cryptocurrency Dog - Mix of Maltese, Beagle, Border Collie, Rottweiler, French Bulldog and Dachshund

Achievements

Racer
Dana Doc
Hey dawg! I'm Dana Doc. I love waking up early then indulging in long afternoon naps. I'll outrun you for the ball if I can...that's just how I roll. I hate it when my human runs out of poop-bags. How embarrassing! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 17%
  • Age 12 days
  • Racing Exp 14
  • Maltese 36%
  • 2 races
  • Gen 3
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 2 0
 Best Time15.73 sec
Rank 77  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTATACACCACCACCACCCACCGACTATACGGA
C
T
A
T
A
C
A
C
C
A
C
C
A
C
C
A
C
C
C
A
C
C
G
A
C
T
A
T
A
C
G
G
A
Genes: DJKKKKH9DJA

Composition

Maltese
36%
Beagle
18%
Border Collie
18%
Rottweiler
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -5 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Maltese
Front Legs Maltese
Head Maltese
Ears Maltese
Snout Rottweiler
Mouth French Bulldog
Nose Beagle
Eyes Border Collie
Color Dachshund

Parents

No Children

Photos

crypto pet race podium Litecoin dog race podium