Juno Juliette Digital Cryptocurrency Game Dog - Mix of Border Collie, Grey Wolf, Golder Retriever, Labrador, Maltese, Dachshund, Husky, Schnauzer and Beagle

Achievements

Racer
Juno Juliette
A-yo...Call me Juno Juliette. In my digital world, cats aren't the only ones who hack. I like never worrying about my dog poo. I've got people for that. My favorite way to spend playtime is a good game of frisbee. I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 3%
  • Age 13 days
  • Racing Exp 9
  • Border Collie 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time15.20 sec
Rank 34  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGATACCCACCCACCGGAACAATACTATACCCC
A
G
A
T
A
C
C
C
A
C
C
C
A
C
C
G
G
A
A
C
A
A
T
A
C
T
A
T
A
C
C
C
C
Genes: 8J5LKA4CDJL

Composition

Border Collie
18%
Grey Wolf
18%
Golder Retriever
9%
Labrador
9%
Maltese
9%
Dachshund
9%
Husky
9%
Schnauzer
9%
Beagle
9%

Current Energy

Vitality +60 points
Lunar Effect -6 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Labrador
Front Legs Grey Wolf
Head Maltese
Ears Dachshund
Snout Husky
Mouth Schnauzer
Nose Beagle
Eyes Border Collie
Color Grey Wolf

Parents

Children

Photos

cryptocurrency canine racing